TagWorks

(No Reviews)
PetSmart, River Hwy #590-G, Mooresville, NC 28117, USA

(704) 660-0444


Contact and Address

Category: Store,
Address: PetSmart, River Hwy #590-G, Mooresville, NC 28117, USA
Postal code: 28117
Phone: (704) 660-0444
Website: https://www.petsmart.com/search/tagworks/

Hours:

Monday:9:00 AM – 9:00 PM
Tuesday:9:00 AM – 9:00 PM
Wednesday:9:00 AM – 9:00 PM
Thursday:9:00 AM – 9:00 PM
Friday:9:00 AM – 9:00 PM
Saturday:9:00 AM – 9:00 PM
Sunday:9:00 AM – 7:00 PM

Location & routing

Get Directions

Most Recent Reviews

There are no reviews yet!
You can review this Business and help others by leaving a comment. If you want to share your thoughts about TagWorks, use the form below and your opinion, advice or comment will appear in this space.

Write a Review


TagWorks On the Web

PetSmart in Mooresville, NC - Mooresville #1095 | Your local pet store

The stores phone number is (704) 660-0444. TagWorks. Temptations.


TagWorks

TagWorks was created by a data scientist and sociologist to efficiently analyze large sets of language files in rich detail. With TagWorks, you'll overcome the tradeoffs of first generation content labelers, so you can extract all the information from every single file.


Tim's Tagworks - Custom Engraved Instrument Tags

Visit Tim's Tagworks, now at Etsy etsy.com/shop/TimsTagworks.


LINKS-IT Pet Tag Connector Video - YouTube

Cute Baby Animals Videos Compilation Cute Moment of The Animals - Cutest Animals #1 - Продолжительность: 10:19 Cute Animal Planet 3 895 660 просмотров. How to Make Dog Tags on a TagWorks Machine.


Įmonės buveinės: Tagworks Pharmaceuticals... - CompanyDutch.com

Šiame puslapyje pateikiama kokius adresus turi įmonė Tagworks Pharmaceuticals B.v. ( Nyderlandai ). CompanyDutch.com. Tagworks Pharmaceuticals B.V. Rodyti įmonės adresus.


WO2014081507A1 - Terminally modified rna - Google Patents

hsa-miR-3152-5p 704 1725 discovered in the breast tumor melanoma. miRNAome, ovary. TEE-660 AACCACTGCTTAAGGAAATAAGAGAGAACACAAAC 5670. Tagworks Pharmaceuticals B.V. Chemically cleavable group. WO2014081299A1 (en).


Tagworks | F6S

I am an of Tagworks. Past Employees. Admin.


Luggage Tags PetSmart - Bing images

www.alldogblog.com. tagworks coupon | All Dog Blog. 660 x 343 jpeg 87kB.